Biosynthesis of Silk Proteins

The transcription, translation and post-translational processing of silk fibroin genes and sericin genes include a series of complex biochemical and cytological processes such as the transport and secretion of silk protein in glandular cells. Silk protein is the general term for two types of proteins, silk fibroin and silk sericin, and is the main component of cocoon silk.

The silk gland of ectoderm origin is the organ that produces silk protein; the glandular cells of the middle silk gland synthesize and secrete sericin, while the gland cells of the posterior silk gland synthesize and secrete silk fibroin.

As a result of long-term artificial selection, the silk glands of the silkworm become more developed and the ability to secrete silk protein is continuously enhanced. In the early 1980s, the cocoon layer weight of the basic variety “BC ₉ ” bred by the original Kyushu branch of Japan’s silk test field has exceeded the record of 1 gram; the cocoon layer weight of the spring varieties popularized in China is generally 0.4 to 0.5 grams. .

The silk protein that forms the cocoon layer is mainly synthesized in the middle and late 5th instar. In just 5 to 6 days, each cell of the posterior silk gland will synthesize about 300 micrograms of silk fibroin, that is, two posterior silk glands (about 1,000 gland cells) will synthesize about 2 mg of silk fibroin per hour. Each gland cell synthesizes 6×10 ⁸ silk fibroin molecules per second on average . Such protein synthesis intensity is rare in other animal cells. The explosive protein synthesis in silk gland cells of 5th instar silkworms has provided a lot of new information for the mechanism of silk protein synthesis, especially the mechanism of silk fibroin synthesis and secretion, due to the progress of molecular biology and gene manipulation technology in recent years.

Synthesis of Silk Fibroin

After the larva enters the 5th instar stage, it adapts to the needs of silk fibroin synthesis, and the metabolic system and subcellular structure of the entire posterior silk gland cells have undergone tremendous changes. Focusing on the synthesis and secretion of silk fibroin, Jean-pierre Garel (1982) divides the changes experienced by the posterior silk gland cells of the 5th instar into 3 physiological periods:

1. Growth: 5th instar and 4 days of food Within, the weight of the posterior silk gland increases rapidly, the DNA within the cell is replicated, the DNA content increases, the silk fibroin gene transcription, translation, and transport secretion system are established, and the silk fibroin messenger ribonucleic acid (mRNA) begins to accumulate.
2. Mass synthesis and secretion period: 75% of the total amount of synthetic silk fibroin in the posterior silk glands and 50% of the total amount of synthetic sericin in the middle silk glands are completed within 4 to 8 days after payment. Under the condition of 22℃, the average speed of silk fibroin synthesis in the posterior silk gland is 4 amino acids/sec/ribosome, that is, within 25 minutes, a nucleosome can convert silk fibroin molecules on the template ribonucleic acid (mRNA). 4,700 amino acid residues are linked together, and the silk fibroin molecules are transported and secreted in the cell faster than this speed, which can be completed in 15 minutes.
3. Spinning and cell dissociation period: In the last 3 days, the silking and cocooning process is completed and the metamorphosis period is entered, and the silk gland cells are digested. After pupation, all the gland cells disappear, and the silk gland DNA is transferred to the fat body tissue for temporary storage.

DNA synthesis in glandular cells, ribosome ribonucleic acid (rRNA) and transfer ribonucleic acid (tRNA) synthesis, silk fibroin template ribonucleic acid mRNA synthesis, and silk fibroin synthesis show a strict time sequence in the 5th instar silkworm, which indicates that silk Element synthesis is also in line with the general law of gene expression, the central law: DNA→RNA→protein.

Silk fibroin gene

The high-efficiency synthesis of silk fibroin in the rear silk gland of the silkworm at the 5th instar stage is firstly related to the number of silk fibroin genes contained in each gland cell. The silk glands of the mulberry silkworm differentiate during embryogenesis, and the cells have stopped dividing during the post-embryonic developmental stage. However, as the chromosomes are replicated, the nucleus undergoes complex branching morphological changes and the cell shape increases. In the larval stage, the chromosomes of the glandular cells divide 19 times (the varieties with low silk production) to 20 times (the varieties with the multifilament production), plus 10 cell divisions during the embryogenesis period, and the chromosomes of the silk gland cells duploid replicate 29 to 30 times. Since the chromosome duplication in the larval stage does not divide the cell, the chromosome in the posterior silk gland cell is polyploid. Silk has been identified containing one gene only within the haploid genome, it is estimated posterior silk gland cells containing a gene of fibroin 5×10⁸ (silk-producing species less) to 2×10⁹ (Multi-filament variety). This is the molecular genetic basis for the high-speed synthesis of silk fibroin by posterior silk gland cells at the 5th instar stage.

The silk fibroin gene is composed of 16,000 base pairs (16 kb) and contains the information DNA part of the synthetic silk fibroin molecule, which is called the silk fibroin structural gene. A and C indicate +1, the positive direction (near the 3′ end) has the ATCAG sequence, the negative direction (near the 5’end) is separated by a C, and there is also the ATCAG sequence, which constitutes the ATCAGCATCAG sequence, of which the second ATCAG That is, it corresponds to the 5’end of the silk fibroin gene, which corresponds to the 5’end of the mature silk fibroin mRNA. +1 is also called the cap site, because it is processed after transcription to form the cap structure m7Gppp AmUm ^CA  of silk fibroin mRNA …. There is a 5′ flanking sequence upstream (negative direction) of the 5’end of the silk fibroin gene, and one of the sequences has a particularly high AT content (up to 75%, while the AT content in the silk fibroin structural gene accounts for 40%), -30 to- 24 is a TATA sequence, which is the promoter of RNA polymerase II. Near the 5’end of the silk fibroin gene, there is an insert of approximately 970 base pairs (the insert ranges from +67 to +1036 base pairs). The codons in this inserted sequence almost all correspond to the amino acids of the hydrophobic signal peptide chain. The hydrophobic signal peptide chain is related to the passage of the secreted protein through the rough endoplasmic reticulum membrane, and is of great significance for the transport and secretion of silk fibroin molecules in the cell. Although the codon for the start of transcription is the +25 position (ATG), the codon that really represents the structure of silk fibroin (ie, the sequence of repeated glycine-alanine codons) does not appear until after +1420 base pairs. In silk fibroin genes, the peptide chain codons of the crystalline part and the amorphous part of the peptide chain codons are arranged regularly. The nucleotide sequence determined from the 3’end of the silk fibroin gene based on the complementary DNA strand is…TACAAAAAAAAAAGCAATTATTTACTCTCGTAA (Sprague，K. U.1979)

Silk fibroin genes not only have operons, but also promoters, which are important parts of regulating transcription.

Silk fibroin gene transcription

Silk fibroin mRNA is synthesized at all ages, but it is decomposed during sleep. Therefore, silk fibroin mRNA is synthesized at the same age in the 5th instar. Silk fibroin mRNA was continuously synthesized throughout the mulberry and mature silkworm stages at the 5th instar, accounting for 4% of the total RNA in glandular cells. The synthesis of silk fibroin mRNA ceased during sleep, indicating that the expression of silk fibroin genes can be regulated at the transcriptional level. Silkworm sleeps 4 times, and the “switch” of silk fibroin gene plays a role in regulating on and off.

The transcription frequency of glycine and alanine (tRNA) in the cells of the posterior silk gland at 5th instar is much higher than that of other amino acid tRNAs. This selective transcription of tRNA is due to the particularly high content of these two amino acids in the silk fibroin molecule.

The transcriptase of silk fibroin mRNA is RNA polymerase II, and the transcriptase of tRNA is RNA polymerase III.

The transcription product silk fibroin mRNA has an average molecular weight of 5.8×10 ⁶ Daltons (6.0×10 ⁶ by electrophoresis and 5.6×10 ⁶ by electron microscopy ), and a sedimentation coefficient of 42s, which is equivalent to 1.6×10 ⁴ bases. Silk fibroin mRNA has a cap structure at the 5′ end, of which 60% are methylated  7^m GPPPA^mU^mCXG structures, and the remaining 40% are unmethylated GPPApy structures. The 3’end has a poly(A) structure with a length of about 100 to 150 bases.

Translation of silk fibroin mRNA

The silk fibroin gene is located on chromosome 25. This gene is transcribed by a specific transcriptase RNA polymerase II and processed into mature silk fibroin mRNA after transcription in the nucleus. It enters the cytoplasm and binds with 50 to 80 ribosomes. Polynucleosomes, where they are translated into silk fibroin.

Like the general protein synthesis process, the translation of silk fibroin mRNA also goes through three stages: initial reaction, elongation reaction, and termination reaction.

Most of the peptide chains in the silk gland cells at the rear of the 5th instar are N-terminal methionine, and tRNAfmet in the gland cells also increases significantly at the time when silk fibroin synthesis is most vigorous, indicating that silk fibroin synthesis starts from methionine.

But in fact, the N-terminus of silk fibroin molecules is not methionine. This is because the protein translated from silk fibroin mRNA is processed after translation, cutting off excess residues including methionine. That is, the methionine codon is used as the starting point of transcription on silk fibroin mRNA to synthesize the silk fibroin precursor (fibroin), and then process it to cut off the excess peptide chain (signal peptide chain) at the N-terminus. This signal peptide Chains are of great significance for silk fibroin to pass through the rough endoplasmic reticulum, especially in the exocrine process.

In the process of silk fibroin synthesis, three elongation factors, namely EFla, EFlb and EF2, participate in the reaction. EFla (molecular weight 51,000) participates in the binding reaction of aminoacyl-tRNAn+1 and nucleoprotein body. In the nucleoprotein body, aminoacyl-tRNAn+1 reacts with peptidyl-tRNAn to extend the peptide chain of the latter by one amino acid. Peptidyl tRNAn+1. This reaction is called peptidyl transfer reaction, which is carried out with the participation of peptidyl transferase without the participation of energy compounds such as ATP and GTP.

The peptidyl group, tRNAn+1, newly generated by the peptidyl transfer reaction , undergoes a translocation reaction under the action of the elongation factor EF ₂ (molecular weight 80,000), and moves from the A position (aminoacyl site) to the P position (peptide chain site). ), this reaction requires the participation of GTP (1 molecule of peptidyl-tRNA translocation, 1 molecule of GTP needs to be hydrolyzed).

EFlb (molecular weight 26000) is an essential factor in the regeneration of EFla activity.

Silk fibroin structure model

The translated gene product, silk fibroin, is composed of a crystalline part and an amorphous part. The former accounts for about 60-65% and the latter accounts for about 35-40%. When silk fibroin is synthesized, the crystalline part and the amorphous part alternate. Translation. The basic unit of the crystalline part is composed of 59 amino acids, that is, Glycine-Glycine-Glycine-Glycine-Glycine-Silk-Glycine-Glycine-Glycine-(Silk-Glycine-Glycine-Glycine-Glycine) 8-phenol. 4 to 7 such basic units (repetitive sequences) constitute a segment, and there are about 10 such segments in each silk fibroin molecule. There is an amorphous part of 200 amino acid residues between the segments connected. When the main chain is transported in the cell, sugar molecules (mannose and glucosamine) are combined with the amorphous part of silk fibroin. In addition, there are coglobulins, which are connected to the main chain by disulfide bonds. This accessory globulin is related to the solubility of silk fibroin and intracellular transport.

Three groups of peptide chains have been found in the amorphous part, with glycine repeats and ending with tyrosine (carboxyl). The number and length of the segments within the silk fibroin molecule may vary between different silkworm species, and the crystalline part and the amorphous part may also vary. The polymorphism of silk fibroin molecules is the fundamental reason for the differences in silk quality among different silkworm species.

Silk fibroin transport and secretion

The synthetic silk fibroin molecular backbone is transferred to the Golgi apparatus through the rough endoplasmic reticulum membrane, where it is concentrated and processed, and certain amino acid residues are combined with sugar molecules to form secretory vesicles, which are disconnected from the Golgi vesicles. The plasma membrane on the top of the proximal gland cells, through the action of microtubules and actin filaments, the silk fibroin molecules are secreted into the lumen of the posterior silk gland in a dissolved state. Silk fibroin molecules enter the Golgi apparatus and are secreted out at a very high speed, usually less than 15 minutes, faster than synthesizing a silk fibroin molecule (25 minutes).

The silk fibroin that is secreted into the lumen of the posterior silk gland flows forward into the middle silk gland (silk storage part) and is stored there until the silk cocoon is spun. The silk fibroin molecules are assembled into microfibrils and filaments, the diameter of which increases from 0.01 microns to 0.4 microns.

Regulation of silk fibroin synthesis

The synthesis of silk fibroin has to go through many stages: the transcription of silk fibroin genes, the translation of silk fibroin mRNA, and the transport and secretion of silk fibroin molecules. At every stage, every link may be subject to regulatory control. The regulation of transcription level not only plays an important role in silk fibroin mRNA, but also plays an important role in the production of tRNA, rRNA and elongation factors related to silk fibroin synthesis, and directly affects the translation of silk fibroin mRNA.

The subcellular components in glandular cells have a decisive influence on the transport and secretion of silk fibroin molecules. Naked pupa mutant (Nd) and thin cocoon mutant (Flc) damaged the transport and secretion of the Golgi respectively. The content of silk fibroin mRNA in the posterior silk gland of naked pupa mutant was less than that of normal line. The normal system is 90 micrograms, the Nd ₁ system is 0.8 micrograms, and the Nd ₂ and Nd-s are 1.3 micrograms. Therefore, it is understandable that the naked pupa mutant system synthesizes a small amount of silk fibroin. But at the same time, the Nd mutant is the endoplasmic reticulum membrane of glandular cells with swelling vesicles, and the Golgi apparatus and mitochondria are underdeveloped, so the transport and secretion of the produced silk fibroin molecules are abnormal. The quality and quantity of silk fibroin secretion granules of Flc mutant line were similar to those of normal line 3 days before 5th instar. However, after 5 years and 3 days, the secretory granules in the endoplasmic reticulum membrane of gland cells of Flc mutant line gradually accumulated, but they could not be secreted. Go into the gland cavity.

Synthesis of sericin

The mulberry silk gland is a highly differentiated organ. The posterior silk gland is specialized in synthesizing silk fibroin, while the middle silk gland is specialized in synthesizing sericin. This tissue-specific gene expression phenomenon in the same organ is one of the biggest features of silk protein synthesis.

According to the speed of electrophoresis movement, sericin can be divided into 4 proteins (gene products, phenotypes), A, B (slow), C (middle) and D (fast). The genes of these 4 phenotypes are all located on the 11th chromosome. superior. The recombination rate between the sericin gene (Src-2) that dominates phenotype C and the sericin gene (Src) that dominates A, B, and C is 7.1, and the chromosome map of the 11th linkage group is: Src(0.0); Src-2(7.1); K(19.2); mp(47.8).

The results of the study on the two isolated mRNAs specific to the central silk gland (11.0kb and 9.6kb represent the messengers of the two sericin proteins) showed that the sericin gene, like the silk fibroin gene, also has a 5′ flanking sequence And at least 3 inserts (the silk fibroin gene has only 1 insert). The nucleotide sequence of the transcription start site in vivo corresponds to the 5’end of mature sericin mRNA. The nucleotide sequences near -111 and -186 in the 5’flanking sequence of the sericin gene are homologous to the 5’flanking sequence of the silk fibroin gene. This may be related to the coordinated expression of sericin genes and silk fibroin genes in silk glands.

In 1 to 4 years old mulberry, sericin mRNA and silk fibroin mRNA are coordinately transcribed and synthesized in the central and posterior silk gland cells, and they disappear at the same time during sleep. Both are likely to be controlled by the same hormone regulation system.

Sericin is a complex of multiple heterogeneous proteins, which can be divided into four types: sericin I, sericin II, sericin III, and sericin IV according to the difficulty of dissolution and the difference in molecular weight. They are synthesized and secreted by gland cells in different parts of the anterior, middle and posterior regions of the central silk gland.

The four sericins secreted by the central silk glands not only have obvious site specificity, but also have a strict time sequence, that is, they secrete sericin IV, sericin III, and sericin II successively from the posterior zone, the central zone, and the anterior zone. With sericin I, and sequentially layered on the outside of the liquid silk fibroin that enters the middle silk gland cavity from the posterior silk gland cavity. Since sericin IV is secreted by gland cells in the posterior zone, it first comes into contact with the silk fibroin that enters the lumen of the central silk gland, and is closely attached to the surface of the silk fibroin as a thin film. Its amino acid composition and secondary structure are different from those of other sericins. , Is the sericin layer most difficult to dissolve in hot water and lye. In the outer layer of sericin IV, there are sericin III, sericin II and sericin I in sequence. Such insoluble and decreasing molecular weight sericin IV, sericin III, sericin II and sericin I present a layered structure on the outside of silk fibroin. The layered structure of liquid sericin in the central silk gland is also generally reflected in the cocoon silk.

The film formed by sericin IV separates the liquid silk fibroin from the liquid sericin in the middle silk gland and prevents the two from mixing. When spinning, the liquid sericin acts as a lubricant and shock absorber. At the same time, when the liquid silk fibroin passes through the thin tube of the front silk gland, the inner layer of sericin IV can prevent the fibrosis of the silk fibroin due to shear stress. Therefore, sericin is of great significance in ensuring the smooth progress of cocoon silk formation.